Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC2420 C. elegans lam-1(ok3139) IV/nT1 [qIs51] (IV;V). Show Description
W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3139 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 536 bp. Deletion left flank: TCCCGTTGGATGGGAGAATATTCAAATTAC. Deletion right flank: ATGGATTCGGACCATCTGGATGTAAAAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2642 C. elegans lam-1(ok3221) IV/nT1 [qIs51] (IV;V). Show Description
W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3221 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 303 bp. Deletion left flank: ATCCCGTTGGATGGGAGAATATTCAAATTA. Deletion right flank: ATCGTTATCAATGTAGACATCTTGCTCTTT. Insertion Sequence: TTGTAGTGAGACCGGAAGCTGAAGGAGATGGATCATGCTCTGATGCTCCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
NK1339 C. elegans rrf-3(pk1426) II; qyIs127 V; qyIs166 X. Show Description
qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.
NK248 C. elegans unc-119(ed4) III; qyIs10 IV. Show Description
qyIs10 [lam-1p::lam-1::GFP + unc-119(+)]. Reference: Ziel JW, et al. Nat Cell Biol. 2009 Feb;11(2):183-9.
NK2629 C. elegans fdgt-1(tm3165) qyIs23 II; qyIs10 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. qyIs10 [lam-1p::lam-1::GFP + unc-119(+)] IV. fdgt-1 formerly known as fgt-1. Reference: Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
NK651 C. elegans unc-119(ed4) III; qyIs108. Show Description
qyIs108 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes; cleaner laminin-dendra expression than NK652. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK652 C. elegans unc-119(ed4) III; qyIs109. Show Description
qyIs109 [lam-1p::lam-1::Dendra + unc-119(+)]. High expression in basement membranes, also accumulates in body wall muscle. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK696 C. elegans unc-119(ed4) III; qyIs127. Show Description
qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.