| NB240 |
C. elegans |
hsr-9(ok759) I. Show Description
Reduced apoptosis after gamma-ray treatment compared to N2. Reference: Ryu JS, et al; PLoS One. (In Press).
|
|
| NB353 |
C. elegans |
hsr-9(ttTi14815) I. Show Description
Reduced apoptosis after gamma-ray treatment compared to N2. Reference: Ryu JS, et al; PLoS One. (In Press).
|
|
| VC573 |
C. elegans |
hsr-9(ok759) I. Show Description
T05F1.6a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| NB390 |
C. elegans |
hsr-9(ok759) I; brc-1(tm1145) III. Show Description
Reduced apoptosis after gamma-ray treatment compared to N2. Double mutant exhibits hypersensitivity to gamma rays similar to brc-1(tm1145) alone. Reference: Ryu JS, et al; PLoS One. (In Press).
|
|
| JEL1000 |
C. elegans |
hsr-9(xoe17) I. Show Description
Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1016 |
C. elegans |
hsr-9(xoe17) I; brc-1(xoe4) III. Show Description
Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1142 |
C. elegans |
hsr-9(xoe17) I; brc-1(xoe4) polq-1(xoe51) III. Show Description
Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1319 |
C. elegans |
hsr-9(xoe17) I; brd-1(xoe18) III. Show Description
Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|