Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC4084 C. elegans T27E7.4(gk5171) IV; irk-2(gk5172) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5171 mutation is G->A, flanking sequences CTCTGATAATAAAACATTTGTAAAGTGTTC and AATGATATTTTTCGTTGCAGATTGTTTTTT. The gk5172 mutation is T->C, flanking sequences GACGCTTTCCACCACTCCTTCCAAAATTGC and GAAAATTTGAAAACATTTGGATTTTCTATT.