Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1957 C. elegans sfxn-1.2(gk3039) II; flp-14(gk1055) III. Show Description
Y37D8A.15, F37H8.4. The allele gk1055 was identified by PCR screening, has been validated by CGH analysis, and can be detected with the following PCR primers. External left primer: CGGCAAGCCTAGTAGGTAGAC. External right primer: CGGAGAGCAATGTTGAGTCCTC. Internal left primer: CCTTTGCCAGTTTTTTCCCTTTGG. Internal right primer: TTCTTACAGGCAATGGCTGGAC. Internal WT amplicon: 2702 bp. Deletion size: 652 bp. Deletion left flank: GAAAAACGAAAATTGGCAGTAGGCAGGCAG. Deletion right flank: ACAGAGAGTAGGTAGACAATAAGCAGGCAA. The allele gk3039 was identified by CGH and not confirmed by PCR. Left flanking probe: TGTTAAATATTGGCCAGAGTTGACTCAATCTTTAGTTAATTTGGCGTAGT. Right flanking probe: CATCTGCCGAATTTTCCTTTATAACATTCCAGAACAAGAACAGTATTGCT. Left deleted probe: ACAGTTTCAGATGCCCGCCAACATGCTCATCAACGGAATGCTCTTGAGCC. Right deleted probe: GAGCTATGGCTGCTGCTCTGTCACTGAATGCGATGGTTAAGGTAAACAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
PHX3323 C. elegans flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. Show Description
Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
ZM8969 C.elegans flp-14(gk1055) III. Show Description
Sluggish, flat, slightly sterile. Derived by out-crossing parental strain VC1957. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9474 C elegans flp-14(gk1055) III; hpSi38. Show Description
hpSi38 [flp-14(+) + NeoR]. Superficially wild-type. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant phenotype. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9519 C. elegans flp-14(gk1055) III; hpSi38; hpIs201. Show Description
hpSi38 [flp-14(+) + NeoR]. hpIs201[ceh-10p::GFP + lin-15(+)]. GFP expression in RID neuron. Neomycin-resistant. hpSi38 is a single copy miniMos insertion a wild-type genomic fragment containing flp-14 and fully rescues the flp-14 mutant behavioral defects and RID axon defects. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
ZM9078 C. elegans hpIs587. Show Description
hpIs587 [flp-14p::GCaMP6::wCherry + lin-15(+)]. CGaMP6 and wCherry expressed in RID, ALA, some head neurons, a mid-body neuron and a tail neuron. Reference: Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.