Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC1169 C. elegans ent-2(ok235) X. Show Description
K09A9.3. Homozygous. External left primer: TTGCCTAGCAGACGTTCCTT. External right primer: TGAGGAAAAATCCAGCCATC. Internal left primer: GCTACCGTCTGACCTACCCA. Internal right primer: CACCTGAGCCTTTGATGGAT. Internal WT amplicon: 3315 bp. Deletion size: 1475 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4121 C. elegans C36B7.3(gk5200) ent-2(gk5201) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.