K09A9.3. Homozygous. External left primer: TTGCCTAGCAGACGTTCCTT. External right primer: TGAGGAAAAATCCAGCCATC. Internal left primer: GCTACCGTCTGACCTACCCA. Internal right primer: CACCTGAGCCTTTGATGGAT. Internal WT amplicon: 3315 bp. Deletion size: 1475 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5200 mutation is C->T, flanking sequences GAGAAACAAATATGCATTGAGTCACCGATT and AGAAGCGGCATCCAAGATCTTTTCATGATA. The gk5201 mutation is G->A, flanking sequences TCTTTTTTTCAACTAATCTACATACTTCCA and GGCTCACTGGATTTTTCACTCTTACCATCA.