Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1311 C. elegans R05D11.8(ok1427) I. Show Description
R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GLW43 C. elegans edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
SHG1687 C. elegans edc-3(ust642[3xFlag::mCherry::edc-3]) I. Show Description
3xFlag::mCherry inserted into endogenous edc-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Zhang Y, et al. Sci Rep. 2021 Oct 13;11(1):20359.doi: 10.1038/s41598-021-99919-0. PMID: 34645931.