Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS8854 C. elegans dmsr-7(sy1539) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of dmsr-7; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATGCTCAGTTGTTTGATCCGAACAGTAACAGTA Right flanking sequence: CGCAGGCATTTCTTCGGAAACTTGCACATTTTCAAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCGAACAGTAACAGTACGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
CHS1127 C. elegans dmsr-4(yum1738) dmsr-6(yum1740) II; dmsr-5(yum1739) III; dmsr-7(yum1741) dmsr-8(yum1742) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PHX2457 C. elegans dmsr-7(syb2457) V. Show Description
Molecular null allele. syb2457 is a CRISPR-engineered deletion of the entire dmsr-7 coding region. Reference: Rossi L, et al. Curr Biol. 2025 Apr 20:S0960-9822(25)00355-0. doi: 10.1016/j.cub.2025.03.039. PMID: 40273913.