Search Strains

More Fields
Strain Species Genotype Add
CB1375 C. elegans daf-18(e1375) IV. Show Description
Dauer defective. Non-crowder. Chemotaxis normal.
RB712 C. elegans daf-18(ok480) IV. Show Description
T07A9.6. Homozygous. Outer Left Sequence: CCTCCGACTGCTCCAGTAAC. Outer Right Sequence: AAGGAATGGCTTGAAGCAGA. Inner Left Sequence: CAGCAAAGGAATTGTCCGAT. Inner Right Sequence: CCCACGACAAATTCTCGACT. Inner primer WT PCR product: 3002. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CB1062 C. elegans daf-18(e1375) IV; vab-3(e1062) X. Show Description
Dauer defective. Notched head. Unlinked double. M-MATING-NO SUCCESS.
PJ1132 C. elegans daf-18(e1375) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Dauer defective. May make bags of worms at low frequency??
AGK573 C. elegans otIs225 II; daf-18(ok480) IV; armEx218. Show Description
otIs225 [cat-4::GFP] II. armEx218 [unc-119p::daf-18 + unc-119p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Transgenic array expresses DAF-18 from unc-119 pan-neuronal promoter; rescues the HSN under-migration phenotype in daf-18 null mutants. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
PJ1272 C. elegans daf-4(m592) III; daf-18(e1375) IV; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Abnormal-looking dauers form at 25C.
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
JN1239 C. elegans daf-18(pe407) IV. Show Description
pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1483 C. elegans daf-18(pe407) IV. Show Description
pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1484 C. elegans daf-18(pe408) IV. Show Description
pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
LRB434 C. elegans daf-18(syb1615) IV. Show Description
D137A. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(D137A) corresponds to human allele PTEN(D92A). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.
LRB435 C. elegans daf-18(syb1618) IV. Show Description
G174E. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(G174E) corresponds to human allele PTEN(G129E). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.
LRB436 C. elegans daf-18(syb1516) IV. Show Description
C169S. Daf-d. L1 starvation sensitive. M-cell arrest defective. daf-18(C169S) corresponds to human allele PTEN(C124S). Reference: Chen J, et al. G3 (Bethesda). 2022 12(6):jkac092. doi: 10.1093/g3journal/jkac092. PMID: 35451480.