Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
UP233 C. elegans eor-1(cs28) IV. Show Description
Deletion allele. Mildly Unc, low percentage larval lethal, low percentage Egl.
UP4013 C. elegans bli-4(cs281) I; csEx919. Show Description
csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.