Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
PS8787 C. elegans col-81(sy1520) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-81. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: caaatatccctctcaattccagCATCGCCGCCGCTC right flanking sequence: TCATCGCTGTCATCGCCATCCCAGCCTTCTACAGC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCGATGACAGCGATGAGAG Method Reference: G3 (Bethesda).
PHX7596 C. elegans col-81::mNG(syb7596) II. Show Description
mNG inserted at C-terminus of endogenous col-81 locus.