Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS8634 C. elegans col-135(sy1435) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-135. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCAGCGCTCGGGTATAATATTCGATATCCCTCCT right flanking sequence: ATGAACCAAATCGACAATATGGCCCATATTCGAATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTCGATTTGGTTCATAGG Method Reference: G3 (Bethesda).