Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
BC10154 C. elegans dpy-5(e907) I; sEx10154. Show Description
sEx10154 [rCes T05B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
GLW93 C. elegans clic-1(utx73[mScarlet-I-C1::3xMyc::clic-1]) V. Show Description
N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.
TV26368 C. elegans wyIs581 IV; clic-1(wy1357) V; wyIs910 X. Show Description
clic-1(wy1357) = endogenous GFP-FLPon-CLIC-1. wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.