Search Strains

More Fields
Strain Species Genotype Add
BC14271 C. elegans dpy-5(e907) I; sEx14271. Show Description
sEx14271 [rCes F38E9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
RB2559 C. elegans F38E9.5(ok3564) X. Show Description
F38E9.5 Homozygous. Outer Left Sequence: gctttggactagcatccgtt. Outer Right Sequence: gtgacagacgcggaagtttt. Inner Left Sequence: tcctcctttgtaccgtaacga. Inner Right Sequence: aggtgtatcgtggcttgtca. Inner Primer PCR Length: 1132. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3103 C. elegans F38E9.5(gk3181) X. Show Description
This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807