Search Strains

ZK1240.2 Homozygous. Outer Left Sequence: tgtagtggttttgctctgcg. Outer Right Sequence: cttggcgatacagttggctt. Inner Left Sequence: aattgccagacgacaaatcc. Inner Right Sequence: tggccggaaattagcataaa. Inner Primer PCR Length: 1130. Deletion size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04G2.8 Homozygous. Outer Left Sequence: tgtcctgggtaggttgggta. Outer Right Sequence: atcccgaatctgtccaatca. Inner Left Sequence: gaccttttcacgaggcaatc. Inner Right Sequence: ggtccttcgacaaccatagc. Inner Primer PCR Length: 1314. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44G3.2 Homozygous. Outer Left Sequence: tgcacagattggtcttcgac. Outer Right Sequence: aggtccaaatgatgtcagcc. Inner Left Sequence: tttcaactctgtgtcttggca. Inner Right Sequence: ccgcattattcgttaagggt. Inner Primer PCR Length: 1144. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02D8.1 Homozygous. Outer Left Sequence: gataaaccacttgccggaga. Outer Right Sequence: tgtgcatgggacacaaagtt. Inner Left Sequence: ccgatggagagaacagctcta. Inner Right Sequence: tcgaaaatcagaagcaacga. Inner Primer PCR Length: 1159. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09F9.2 Homozygous. Outer Left Sequence: aatccactgctccaacaacc. Outer Right Sequence: gtgactccatcctcctggaa. Inner Left Sequence: aagtgtgaacggggatgtct. Inner Right Sequence: aggtgtagccttcgatggtg. Inner Primer PCR Length: 1257. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16E9.2 Homozygous. Outer Left Sequence: tgttgctgaagcaattcgac. Outer Right Sequence: ccccctttgaaaacaagaca. Inner Left Sequence: gttggcaacacagcaaggta. Inner Right Sequence: cagctcgttctcctcgtttc. Inner Primer PCR Length: 1373. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40F9.2 Homozygous. Outer Left Sequence: tcgctactttcccgcttaaa. Outer Right Sequence: tttcagtttgccatcacagc. Inner Left Sequence: tcgtaattatttgtgaaatgaaactt. Inner Right Sequence: cagaaccgtttcaggattgg. Inner Primer PCR Length: 1253. Deletion size: about 800bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C6.4 Homozygous. Outer Left Sequence: aattctctgctcgtcggaaa. Outer Right Sequence: tcaatatgcacacagcgaca. Inner Left Sequence: tcgaggccgaagataaggat. Inner Right Sequence: gctttttaggctttctcgtgg. Inner Primer PCR Length: 1143. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R08C7.6 Homozygous. Outer Left Sequence: acggaacatttttcaaggca. Outer Right Sequence: accccaccaatcaacgataa. Inner Left Sequence: gcgacatttgcacaattaca. Inner Right Sequence: gagttggacgccactgattt. Inner Primer PCR Length: 1201. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.21. Homozygous. Outer Left Sequence: ACATCTCACGGGTTCCACTC. Outer Right Sequence: TCGTAAGATTCAGCGCAATG. Inner Left Sequence: AAGTTCCCGATTCCTTGGAT. Inner Right Sequence: GCGTTCTACCAAAGCTACCG. Inner Primer PCR Length: 1249 bp. Deletion Size: 456 bp. Deletion left flank: CTCAAGGATCACAGGCTTCAACATATCCGC. Deletion right flank: AAACAAAGTTTTGAGCTTTTAACGTAAGTT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28C12.9 Homozygous. Outer Left Sequence: tcgtcgatcaatcctgacaa. Outer Right Sequence: cgttaatacttcgtggccgt. Inner Left Sequence: caacgaagactctagggcgt. Inner Right Sequence: cccggccatattatttttga. Inner Primer PCR Length: 1333. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R13H9.5 Homozygous. Outer Left Sequence: aatgaactcaaaacgggacg. Outer Right Sequence: tgtaatgacgcttgtcggaa. Inner Left Sequence: cggttccagtccagtctgat. Inner Right Sequence: agtctttgcaggtaaatacgagtt. Inner Primer PCR Length: 1218. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y113G7B.14 Homozygous. Outer Left Sequence: ggacccctgacatgaacttg. Outer Right Sequence: gtctcgaaagtcgtcttggc. Inner Left Sequence: tgtccgacaatgagaatgga. Inner Right Sequence: tttcatcatcggaacaagca. Inner Primer PCR Length: 1147. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y18D10A.19 Homozygous. Outer Left Sequence: agtcgaagctcacgattgct. Outer Right Sequence: cggagatttcgacttcaagg. Inner Left Sequence: ccgtagccaggagaaaaatg. Inner Right Sequence: ttatggagaggttgcacacg. Inner Primer PCR Length: 1148. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09D12.1 Homozygous. Outer Left Sequence: tcgtcatctttttgtcgctg. Outer Right Sequence: attgaaccaatagttgcggg. Inner Left Sequence: ttcttgtgttccaaaagggc. Inner Right Sequence: ttgagatagggtaaaagaagatcg. Inner Primer PCR Length: 1202. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38B6.6 Homozygous. Outer Left Sequence: aaacgtgtaccgagattcgc. Outer Right Sequence: tggtgaatggatttgaagca. Inner Left Sequence: aacaaaactgaagttggattcagaaacaaaactgaagttggattcaga. Inner Right Sequence: gggatgcatttcctccatta. Inner Primer PCR Length: 1214. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34F6.3 Homozygous. Outer Left Sequence: cctgccactaaagagaacgc. Outer Right Sequence: gcggaaacaaggattatgga. Inner Left Sequence: ggttgcaaagtgattgcaga. Inner Right Sequence: tggtaagaaacgttcacgca. Inner Primer PCR Length: 1291. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC416.2 Homozygous. Outer Left Sequence: ctggggtcaaaagtcggtta. Outer Right Sequence: gttaaaattgtctgccgcgt. Inner Left Sequence: tcccaaactccaatttccag. Inner Right Sequence: gcatcggggtgactcttact. Inner Primer PCR Length: 1235. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06H6.3 Homozygous. Outer Left Sequence: gcaaatactgaacccgcaat. Outer Right Sequence: ccgacgaatttttcagcatt. Inner Left Sequence: ttttatttcggattgccagg. Inner Right Sequence: ttttcaaagtagacgccttcaa. Inner Primer PCR Length: 1395. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y50D7A.6 Homozygous. Outer Left Sequence: atcacaacgggaatctggag. Outer Right Sequence: ttcaacggcaaaaatgttca. Inner Left Sequence: gaatttggaatcctcccgat. Inner Right Sequence: tcatatttctcacctcaatttctca. Inner Primer PCR Length: 1132. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y75B12B.2 Homozygous. Outer Left Sequence: acttccggattgttgacctg. Outer Right Sequence: agctcatccgtgtgcttctt. Inner Left Sequence: gtgaagagctggcaacaatg. Inner Right Sequence: tgattcccgctctattaccg. Inner Primer PCR Length: 1175. Deletion size: about 600 bp. cyn-7 was formerly known as cyp-7. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC395.10 Homozygous. Outer Left Sequence: cttgcccatggaaactgatt. Outer Right Sequence: caatgccattcgcacttaaa. Inner Left Sequence: gaaaaacgaatgcgggataa. Inner Right Sequence: tcttgcttgttattgccgtg. Inner Primer PCR Length: 1195. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47A4.1 Homozygous. Outer Left Sequence: gcccgaagaagattaccaaa. Outer Right Sequence: acgacccaacgaacagaaac. Inner Left Sequence: tcctttcattcttttgctcaca. Inner Right Sequence: aagcggaaagtgtttctcctc. Inner Primer PCR Length: 1179. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C56A3.1 Homozygous. Outer Left Sequence: tgattggcacatagtcggaa. Outer Right Sequence: ctacgttcaaagcggaggag. Inner Left Sequence: aaatgacagattgaagcggg. Inner Right Sequence: gaaaaacatggcaaccttcc. Inner Primer PCR Length: 1162. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y50D7A.10. Homozygous. Outer Left Sequence: CCGCCCCTTTAATAGAAACC. Outer Right Sequence: GTACGAGGAGTCCGCACATT. Inner Left Sequence: TTTGTTTTCCGCCTGTTTTC. Inner Right Sequence: ATATTTGCCAAGAAAGGGGC. Inner Primer PCR Length: 1152 bp. Deletion Size: 741 bp. Deletion left flank: TTTTTTTGCGAAAATCTCGGCTTTTTCACC. Deletion right flank: TGTAGAGCTAAACTTAAACGAAAAATGGTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04A4.6. Homozygous. Outer Left Sequence: GAGACATGCGTCAGCAAAGA. Outer Right Sequence: GCAATTTCAGCATCCGATTT. Inner Left Sequence: GCTTGCGTCCTTCTTGACTT. Inner Right Sequence: TGGAACTCAAAATGTGATAACGA. Inner Primer PCR Length: 1379 bp. Deletion Size: 515 bp. Deletion left flank: AAGGAAGAACACAGGAGATGGTGCAATAGA. Deletion right flank: CTGTCATATTCCTTTTCGTTATCACATTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07C6.4. Homozygous. Outer Left Sequence: AATTCTCTGCTCGTCGGAAA. Outer Right Sequence: TCAATATGCACACAGCGACA. Inner Left Sequence: TCGAGGCCGAAGATAAGGAT. Inner Right Sequence: GCTTTTTAGGCTTTCTCGTGG. Inner Primer PCR Length: 1144 bp. Deletion Size: 480 bp. Deletion left flank: ATCTCTGGTTAGCTGGTCAAGATACCACTT. Deletion right flank: TTGGAAATCTTATCCTGCGATATGACATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71G12A.3. Homozygous. Outer Left Sequence: AGGCGACTTCTCTCCCTCTC. Outer Right Sequence: TCATCATTATCGCCGATTCA. Inner Left Sequence: GTGTGTGTGTGTGTGTGCGT. Inner Right Sequence: TCCTTTCCACCAACGGATTA. Inner Primer PCR Length: 1267 bp. Deletion Size: 522 bp. Deletion left flank: GGTGTTAGGCTTTTCCACTGGAACTATTCA. Deletion right flank: TAAGCTGCCGATTCCACTCAAGGAGATGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25F6.6. Homozygous. Outer Left Sequence: AAAGACGATGGAGGCAAATG. Outer Right Sequence: CCCCTAGGTGGCTTGACTTT. Inner Left Sequence: CAACATCTTCACCGTCACCA. Inner Right Sequence: CAACGTCACAATTCACTTGC. Inner Primer PCR Length: 1278 bp. Deletion Size: 637 bp. Deletion left flank: ATGCGGGACTCAAACTTCTGAGTGAAAAGT. Deletion right flank: AAAAAAATAGAATGTTACTAAGGACAAGGA. Insertion Sequence: ATAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03G1.5. Homozygous. Outer Left Sequence: TCGAGATGTCTTCGCCTTTT. Outer Right Sequence: GTGGTGAAGCTGTACGCTGA. Inner Left Sequence: GGAGTCTGGTGGAAATTGGA. Inner Right Sequence: GGTGAGAAGGATCTGAAGGG. Inner Primer PCR Length: 1356 bp. Deletion Size: 612 bp. Deletion left flank: TCCATGGCGTCCTGGACAATGTGGTGGGCC. Deletion right flank: TCATTTTCGTCATCGCTGCTTTCCGATCCT. Insertion Sequence: TCG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49F5.1. Homozygous. Outer Left Sequence: AGGACTTGCGAGAGTACGGA. Outer Right Sequence: CTTGAGAGCTTTTGGCTGCT. Inner Left Sequence: AGTGAATCTGTGTCCGAGGG. Inner Right Sequence: GGGAACTCAGAGTGACCGAA. Inner Primer PCR Length: 1248 bp. Deletion Size: 480 bp. Deletion left flank: ACTCCGCGTTCACACTGTTGTGGTCTCTAC. Deletion right flank: TAGATAGGAGAAATTTCATTGGTTTTTTAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.5. Homozygous. Outer Left Sequence: ACGAATGTTGATCGGTGACA. Outer Right Sequence: AAATGTGGCTCTTTTGCAGC. Inner Left Sequence: GCTGCCAGGATTTATGCTTC. Inner Right Sequence: GCCGACACTTTTTGGGTTT. Inner Primer PCR Length: 1161 bp. Deletion Size: 672 bp. Deletion left flank: GGTAAGTTCCTAGCACTCTGGTTTCCAACT. Deletion right flank: TCTAGACGATTTGGCAGAGTATGTTAATTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20D12.3 Homozygous. Outer Left Sequence: gaatcggatcaaggacctca. Outer Right Sequence: tatgtggatcaacgttgcca. Inner Left Sequence: tggatgataatgtcgaacttgc. Inner Right Sequence: tttacacatctcaaaaatcagtgaa. Inner Primer PCR Length: 1215. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M05D6.4. Homozygous. Outer Left Sequence: ACTGTTGGGCCATACTCGAC. Outer Right Sequence: AGCAAAAATGCGCTTCATCT. Inner Left Sequence: CAATTGGAGAGAAGCCGAAG. Inner Right Sequence: AAAACAATGGCAAGATATAAACTGT. Inner Primer PCR Length: 1228 bp. Deletion Size: 539 bp. Deletion left flank: ATTGTGTTCAAATTCTTTAAGCATAAAACC. Deletion right flank: ATGCTCAATTGAAAACATTAAGTTTTTATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC487.4. Homozygous. Outer Left Sequence: CGATGTGATTTATTGCACGG. Outer Right Sequence: CTCTCCTGGCTTTTACGCAG. Inner Left Sequence: GTGAATGGAGGAAAGCGAAG. Inner Right Sequence: CCGAATGGACAAGTTGGAAG. Inner Primer PCR Length: 1291 bp. Deletion Size: 253 bp. Deletion left flank: GTGGAAGTTGAACCTGTTGCTGTTGCAGTT. Deletion right flank: AATTTTAGGCGAGTGAACACACAAAAGTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47D12.8 Homozygous. Outer Left Sequence: ctcaacgccttccaagactc. Outer Right Sequence: caggatcccataaaggctca. Inner Left Sequence: tttgtaccgcgaaaagaagc. Inner Right Sequence: tgaaaatggcgagaaaaacc. Inner Primer PCR Length: 1181. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24D11.1. Homozygous. Outer Left Sequence: GGATTGAAGTGGCTTTCCAA. Outer Right Sequence: AGAGTCAAATGCCGAAAAGC. Inner Left Sequence: TTTTCAGGCAAAATGCAGC. Inner Right Sequence: AGGCTCAAGTAGGCTCAAGTG. Inner Primer PCR Length: 1237 bp. Deletion Size: 856 bp. Deletion left flank: AGATTGAGAGAAAATGGGAATGGATCGGAG. Deletion right flank: TGATAACGTTGAACAGAAGTGATTGGCCTC. Insertion Sequence: TGGGAATGGATCGGAGTGGATCGGAAATGGAATGGATCGGAAATGGGAATGGATCGGAG . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37B1.1. Homozygous. Outer Left Sequence: GCGACGATTCATGGTCTTTT. Outer Right Sequence: CTCTCCCTCCCCTCAATTTC. Inner Left Sequence: CAAACTCCCCAGGTGTGACT. Inner Right Sequence: GGAGATTTTCGAAACGACTTTG. Inner Primer PCR Length: 1157 bp. Deletion Size: 555 bp. Deletion left flank: TCATTAACCTTCTCACGGAGCGCTGCAAGC. Deletion right flank: AGTTATACAAATACCACTAAAAATGTTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32H2.6. Homozygous. Outer Left Sequence: GGAAGACGAGCTTCCAGATG. Outer Right Sequence: TCTCGACGGTTTCCGTTATC. Inner Left Sequence: GAGGAAGAAGCTCAGGGTCC. Inner Right Sequence: CATCTGTGCCGTGCAGTAAT. Inner Primer PCR Length: 1288 bp. Deletion Size: 380 bp. Deletion left flank: ATGCCACCGAACATTTTGACTTCTTTATTA. Deletion right flank: GACGACTATCCTTTGTGGCAAAAGAAGAGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A11.1. Homozygous. Outer Left Sequence: GCGAAATTTCACGTTTTTCC. Outer Right Sequence: AAAATCCGCAGCAATGAAAG. Inner Left Sequence: AATACGGTACCCGGGGTCT. Inner Right Sequence: TTGGTCTTTTTAGGCCTTGC. Inner Primer PCR Length: 1113 bp. Deletion Size: 722 bp. Deletion left flank: TTTAAAGGCGCACTTTTTTCGAATTTAACC. Deletion right flank: GAGAGGAAATGCACGAAAAAGGTCCACATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03B4.7. Homozygous. Outer Left Sequence: TCGAGGATCTCAAGGATTGG. Outer Right Sequence: CCAAATAGACCCGCAACATT. Inner Left Sequence: CTCGACTCGTTGACGACCTT. Inner Right Sequence: TTTGATCTACTCTTTTAGCCAGTTT. Inner Primer PCR Length: 1258 bp. Deletion Size: 979 bp. Deletion left flank: TGCTTTGAGCAAAAAAAATTGAAAGAACGT. Deletion right flank: GTGCGGGGAGAGTGACCAGAAACTGATGAG. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06A4.1. Homozygous. Outer Left Sequence: CTTAAAGGTCGAAGCATGGC. Outer Right Sequence: TGTTGAAGCACAAAGATCGG. Inner Left Sequence: TTCACCCACTCCAACTTCTAA. Inner Right Sequence: CGGCGCTTTCTGAAATAAAA. Inner Primer PCR Length: 1162 bp. Deletion Size: 377 bp. Deletion left flank: CTCCGAACCACCAAAGGATGACGATATCGC. Deletion right flank: TGGCTCTTCGGAACTCGTGATGGAAAAGTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK896.9. Homozygous. Outer Left Sequence: GGCTCACAAAAGCAGAAACC. Outer Right Sequence: TGCCCATTTTCCACTTTTTC. Inner Left Sequence: TCAAATACTCATCACTGGTGGTTC. Inner Right Sequence: ACGGTCACTCGTCCATTTTC. Inner Primer PCR Length: 1146 bp. Deletion Size: 590 bp. Deletion left flank: TTGCCAAGTGAGATTATTAGCTTAAAATCC. Deletion right flank: ATCACGAATTCTTCGTCAACTGGAGGGATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08D10.7. Homozygous. Outer Left Sequence: GCAATTAGCTTAACGTCCGC. Outer Right Sequence: GTTTGCAAGTGAAATGGGCT. Inner Left Sequence: GTCACCTGAGGAGGTTGAGC. Inner Right Sequence: ACATCTCCTGCATGAATCCC. Inner Primer PCR Length: 1122 bp. Deletion Size: 407 bp. Deletion left flank: GACTGTAAGTCATTCTAGCTAATGGTGACC. Deletion right flank: CAGTAATAACTACAGTACTACATTAAACTA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC395.10. Homozygous. Outer Left Sequence: CTTGCCCATGGAAACTGATT. Outer Right Sequence: CAATGCCATTCGCACTTAAA. Inner Left Sequence: GAAAAACGAATGCGGGATAA. Inner Right Sequence: TCTTGCTTGTTATTGCCGTG. Inner Primer PCR Length: 1196 bp. Deletion Size: 816 bp. Deletion left flank: AAGAATTAAATTAGAGAAATTCAAATTGTA. Deletion right flank: ATTCGAAAAGAGAACTAGACGGATACGAAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55A4.1. Homozygous. Outer Left Sequence: GCATTGGGACAGAGGAGGTA. Outer Right Sequence: TGCACTGACCAAAAGGAATG. Inner Left Sequence: ATGCACATCCCACAACACAT. Inner Right Sequence: GTGGCGACTGGCTTAAAAAT. Inner Primer PCR Length: 1221 bp. Deletion Size: 736 bp. Deletion left flank: TCCTTTCAATGCGTATTTCACCATCGTTTT. Deletion right flank: AAACACGCAATGAATACGGTATCCAATGAG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W09G10.4. Homozygous. Outer Left Sequence: CGGAAAATCGAAAAATGTCC. Outer Right Sequence: AAATCACCAATTTTCGCCAC. Inner Left Sequence: TCTCAATCTCCTGTTCCCTCA. Inner Right Sequence: ATTTTCCCCCAATTTTCCAG. Inner Primer PCR Length: 1120 bp. Deletion Size: 457 bp. Deletion left flank: GCTTTGAGCATTGATTCGAGCACACCTTGT. Deletion right flank: ACGGTTACATCTTGGATCTGGAAAATTGGG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17A2.3. Homozygous. Outer Left Sequence: CGGGGCCTAAATATGAGGTT. Outer Right Sequence: ACCAGTGAAGGATTTGTGGC. Inner Left Sequence: GTACACGCCACGCAGTTTTA. Inner Right Sequence: GAACAACGTGAAAGTGGCAA. Inner Primer PCR Length: 1321 bp. Deletion Size: 578 bp. Deletion left flank: AAGCAAACAAACACGGTTGGAATAGGATCC. Deletion right flank: CACTAACGACAGCCTCGACACCACAGCATC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C5.9 Homozygous. Outer Left Sequence: gcaggaaatgcattgtcaaa. Outer Right Sequence: cttcaagatgagccccaaaa. Inner Left Sequence: tctgattgtgataatcgccc. Inner Right Sequence: tccgtgaacgaatgtctgaa. Inner Primer PCR Length: 1173. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807