Search Strains

F53G2.1 Homozygous. Outer Left Sequence: agagaattggaacggggaat. Outer Right Sequence: tcggcttcctgacaactttt. Inner Left Sequence: agaagtctggcattgaaacga. Inner Right Sequence: tcgtcgtttcgaattgttttt. Inner Primer PCR Length: 1119. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01D3.2 Homozygous. Outer Left Sequence: gcatcgagggaaaatgttgt. Outer Right Sequence: aaccgtcaaaatcacaagcc. Inner Left Sequence: tgaggaaacaaatgtgatcgag. Inner Right Sequence: ggcaagagcaatttctggac. Inner Primer PCR Length: 1199. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK643.8 Homozygous. Outer Left Sequence: gaggatcgtcttattccggc. Outer Right Sequence: gagaccttgctctccacagg. Inner Left Sequence: gaggagaagcatcatcgtca. Inner Right Sequence: cgagatttgacacgttgagc. Inner Primer PCR Length: 1236. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK520.5 Homozygous. Outer Left Sequence: atggaaaatttgaacgtcgg. Outer Right Sequence: atggaaagttagttcggggg. Inner Left Sequence: tgcgaaaagaatcgatcagc. Inner Right Sequence: attccacaaacttgcatccc. Inner Primer PCR Length: 1235. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02E4.1 Homozygous. Outer Left Sequence: ttattcagatgggtttcggc. Outer Right Sequence: ttcgcaaagttcgactcctt. Inner Left Sequence: cgctgccaaataacaacctt. Inner Right Sequence: ttcttggttgatcaaatacctttt. Inner Primer PCR Length: 1103. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R12A1.2 Homozygous. Outer Left Sequence: gcagtcggactatctttgcc. Outer Right Sequence: gatgcattatgagctggggt. Inner Left Sequence: gcacactaacctatcccagtcc. Inner Right Sequence: gtaattcgcgccaacaatct. Inner Primer PCR Length: 1139. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R03G8.4. Homozygous. Outer Left Sequence: tgaggattttctggacctgg. Outer Right Sequence: cagagcggtaacgagctagg. Inner Left Sequence: gcattgaatcctcatttaggc. Inner Right Sequence: ctcacggtgcaattggaaat. Inner Primer PCR Length: 1169. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence: ccagactgtccaaaatccaga. Inner Primer PCR Length: 1146. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42D1.3 Homozygous. Outer Left Sequence: tgcctctgacacaattcgac. Outer Right Sequence: aattcagttgactgccgctt. Inner Left Sequence: agtttatgggcaggtttgtga. Inner Right Sequence: ttcaaagcccaatttcaagc. Inner Primer PCR Length: 1210. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11E3.4 Homozygous. Outer Left Sequence: gatgtttgaaaggcttggga. Outer Right Sequence: cggtgaaactcacaggacaa. Inner Left Sequence: tcattaacatgagctactcgtcg. Inner Right Sequence: gctttccttgtgcctacacc. Inner Primer PCR Length: 1178. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14H8.6 Homozygous. Outer Left Sequence: caggagggtatccccaattt. Outer Right Sequence: gctcgtcgagaaacttttgg. Inner Left Sequence: ccagagtcagtgcagaccag. Inner Right Sequence: tgttcaggcacttcgaggat. Inner Primer PCR Length: 1263. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18A12.6 Homozygous. Outer Left Sequence: catccggcaacaaacctact. Outer Right Sequence: gttcaacttttccgtcgcat. Inner Left Sequence: gcgaagttctgggcaattta. Inner Right Sequence: tggtttccagtgcttttcag. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D5.14 Homozygous. Outer Left Sequence: gctgcaatcaatttgggtct. Outer Right Sequence: tggatcgatcaacgtgatgt. Inner Left Sequence: atcgaggaaacacggtgaag. Inner Right Sequence: tgtgtgagccgaatctgaaa. Inner Primer PCR Length: 1283. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09F5.1 Homozygous. Outer Left Sequence: ctccgtcatgggaactgaat. Outer Right Sequence: catttcgccaaaagaggtgt. Inner Left Sequence: cttgacggcaggctataagg. Inner Right Sequence: agtgagccagtgtgctttga. Inner Primer PCR Length: 1324. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E2.4 Homozygous. Outer Left Sequence: tgcctcctcgcaataatctt. Outer Right Sequence: ttgccgaaaattaccgattc. Inner Left Sequence: ccaactggaaaacaccacaa. Inner Right Sequence: caatttgtccatttgccgat. Inner Primer PCR Length: 1208. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47G4.6 Homozygous. Outer Left Sequence: ttttgcggaatcctcagttt. Outer Right Sequence: ggggtacttaccaggggtgt. Inner Left Sequence: aaacttgaaattttcggttcca. Inner Right Sequence: tcaatatttgccgagcacag. Inner Primer PCR Length: 1199. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C56E6.6 Homozygous. Outer Left Sequence: tctaattgatttcccgccag. Outer Right Sequence: cgatgttctgcgttccaata. Inner Left Sequence: aggtgttgcaatttcggaag. Inner Right Sequence: tgtcgttctaatgctggcaa. Inner Primer PCR Length: 1117. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44E4.6 Homozygous. Outer Left Sequence: gccaaaggctaagcgtactg. Outer Right Sequence: gtttcagtcgcttcgagacc. Inner Left Sequence: ccgccgagtaatttcatctt. Inner Right Sequence: aacaattgctggcgattagg. Inner Primer PCR Length: 1354. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H1A.5 Homozygous. Outer Left Sequence: cgccgaaaatacggtatcac. Outer Right Sequence: tttcttctggaaaatgcgct. Inner Left Sequence: gggtctcgacacgaaaattg. Inner Right Sequence: gatcttgaatgcgtggtgtg. Inner Primer PCR Length: 1312. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14H12.6 Homozygous. Outer Left Sequence: ggaaatgccaaggcagatta. Outer Right Sequence: tccaacacgaaaatgtgagc. Inner Left Sequence: tttccgtgttttaagataagaacaaa. Inner Right Sequence: ctaaccttctgcatcctcgc. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E03G2.3 Homozygous. Outer Left Sequence: tagttttcgagatacgggcg. Outer Right Sequence: aaataaaaacgtgcaagcgg. Inner Left Sequence: ttgtcaaaaacggactcacg. Inner Right Sequence: tgttcccaatctccatcaca. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y44A6D.3 Homozygous. Outer Left Sequence: tggacaacccgtagacacaa. Outer Right Sequence: gaaatgcatggttacggctc. Inner Left Sequence: aggtgttccaccagcacaat. Inner Right Sequence: gtcggttttcaaaatttccg. Inner Primer PCR Length: 1323. Deletion size: about 200 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06E7.3 Homozygous. Outer Left Sequence: gtgggggctactgattttga. Outer Right Sequence: gttctcgtccgaaacgtcat. Inner Left Sequence: agctggtccttgtgatttgg. Inner Right Sequence: acgatgattcctcgaaaggt. Inner Primer PCR Length: 1141. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A8.5 Homozygous. Outer Left Sequence: gccaccattcagcaattttt. Outer Right Sequence: accgatccgttgtgtttttc. Inner Left Sequence: tgaacgctgagcatccatag. Inner Right Sequence: cgcccgttttcttttaatg. Inner Primer PCR Length: 1218. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F53A3.2 Homozygous. Outer Left Sequence: acatctccgattggcgtaag. Outer Right Sequence: gaatactcagccaagcagcc. Inner Left Sequence: atttttgggcgaatttttcc. Inner Right Sequence: cgattgcagtgcactttagg. Inner Primer PCR Length: 1237. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21E12.3 Homozygous. Outer Left Sequence: ataccgtaatcgggtgttcg. Outer Right Sequence: catgcaacactggctcattt. Inner Left Sequence: gattcgtaacgctcgatgtg. Inner Right Sequence: tgatcagcaattgccctaga. Inner Primer PCR Length: 1340. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D3A.1 Homozygous. Outer Left Sequence: ccactttcctgattcccaga. Outer Right Sequence: agccaacgttcgaaacaaac. Inner Left Sequence: gacgttgatggctccatttt. Inner Right Sequence: cccactttacatggtttggg. Inner Primer PCR Length: 1248. Deletion size: about 250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08E4.2 Homozygous. Outer Left Sequence: aactccaatgaaaccgcaac. Outer Right Sequence: ttttctctgtgccctccagt. Inner Left Sequence: ctgcaaaatgcatagcgaaa. Inner Right Sequence: tgtttgttctgatacatggcaa. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09C8.2 Homozygous. Outer Left Sequence: acacgaggcccactgtaatc. Outer Right Sequence: cgttcaaacacaaccacctg. Inner Left Sequence: cgtaaggaacgagggatcaa. Inner Right Sequence: cggtctccctatcttcacca. Inner Primer PCR Length: 1171. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13H8.11 Homozygous. Outer Left Sequence: aaccaggagagcttgcaaaa. Outer Right Sequence: cttcttgaaaatggcacggt. Inner Left Sequence: ctgaaggaactcggagaaatc. Inner Right Sequence: gcgtttatggattcaatggg. Inner Primer PCR Length: 1272. Deletion size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02C1.1 Homozygous. Outer Left Sequence: tgttcttctttccctcccct. Outer Right Sequence: tcgagaatcattcaacgcaa. Inner Left Sequence: cctttcgttcttaccttccg. Inner Right Sequence: ggtaaacaaaaagtggacaatgg. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R10D12.14 Homozygous. Outer Left Sequence: aagagcgagatgacgaggaa. Outer Right Sequence: accatttgtccgagcaactc. Inner Left Sequence: gacatcaaaataccgacggc. Inner Right Sequence: gaacacgagaagcctgttcc. Inner Primer PCR Length: 1196. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G11.7 Homozygous. Outer Left Sequence: aatgtctgcgaatctcccac. Outer Right Sequence: aaaagcatacggacactggg. Inner Left Sequence: atctcattttccccgctttt. Inner Right Sequence: aaaaggattgatggaataaatcaga. Inner Primer PCR Length: 1184. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11F9.5 Homozygous. Outer Left Sequence: ccactttgcataatctcgca. Outer Right Sequence: catatagcccgcatccaaat. Inner Left Sequence: tccaatcagagctacgagca. Inner Right Sequence: tgattctacaatgacagctggttt. Inner Primer PCR Length: 1244. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK353.8 Homozygous. Outer Left Sequence: tggcccatcgtttttcttag. Outer Right Sequence: agatggccagattttcgatg. Inner Left Sequence: tcgagtcttgttgttttccg. Inner Right Sequence: ggcaacatatcgattcgtca. Inner Primer PCR Length: 1251. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53B7.4 Homozygous. Outer Left Sequence: tccagaccggaggatacaag. Outer Right Sequence: atggcaaacttttgggtgac. Inner Left Sequence: tttgagcattagagtgagtttttg. Inner Right Sequence: ccagtaggcatagtggggtg. Inner Primer PCR Length: 1276. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C24G6.3 Homozygous. Outer Left Sequence: aaaattggattttggagggg. Outer Right Sequence: gccattattgccgattttct. Inner Left Sequence: tctttgacggtttttctgaatg. Inner Right Sequence: tttgaaaagttaaaaacatacagatgc. Inner Primer PCR Length: 1193. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A7.9 Homozygous. Outer Left Sequence: cctacacctgcctacttgcc. Outer Right Sequence: ccctacagtactccggcaga. Inner Left Sequence: ctaccaaagacgccttaccg. Inner Right Sequence: ttctccaatcaactacctccaa. Inner Primer PCR Length: 1194. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13B5.8 Homozygous. Outer Left Sequence: tgcaaatcagctctaatgcg. Outer Right Sequence: ggtggccgagtctaaagtca. Inner Left Sequence: aagtgtttcaagtgcgctcc. Inner Right Sequence: ccagttttccgtcgattttc. Inner Primer PCR Length: 1164. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK270.2 Homozygous. Outer Left Sequence: catatgcaaaggtgtccacg. Outer Right Sequence: tcttcagcaaggcatctcct. Inner Left Sequence: gaagtgatgtattcctgtttcgt. Inner Right Sequence: agccttcagagaaatcgtcg. Inner Primer PCR Length: 1225. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13D2.2 Homozygous. Outer Left Sequence: aagcgggattcgaaggtatt. Outer Right Sequence: tcaaaacgttgcttgcattc. Inner Left Sequence: tgtcacagatagggaccgaa. Inner Right Sequence: ctagttgacggtagcaacgc. Inner Primer PCR Length: 1136. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01B12.3 Homozygous. Outer Left Sequence: aaccatttccctcatttcca. Outer Right Sequence: tcatcatcctctcccaaagg. Inner Left Sequence: tcactcgatgttgcttcttctt. Inner Right Sequence: gagaagcacttcggcaactt. Inner Primer PCR Length: 1105. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08E3.13 Homozygous. Outer Left Sequence: gtcgaaaagttgccgaagtt. Outer Right Sequence: tcttcaaattaccaaggccg. Inner Left Sequence: acagccctggtgcagaacta. Inner Right Sequence: ggaaatgcgaatcccaacta. Inner Primer PCR Length: 1267. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54B8.5 Homozygous. Outer Left Sequence: tgcgaaacattccacagaaa. Outer Right Sequence: agatggcagacacgaagaca. Inner Left Sequence: agtttccagaagtcatgccc. Inner Right Sequence: cacagagtacgcttgcaaaa. Inner Primer PCR Length: 1126. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08D8.2Homozygous. Outer Left Sequence: ttacagaggcaatgcacgag. Outer Right Sequence: aaccggggatatcatcacaa. Inner Left Sequence: ccgaattgtttcttgggatg. Inner Right Sequence: tacaatccgttgcgtcaaaa. Inner Primer PCR Length: 1182. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C8.5 Homozygous. Outer Left Sequence: ttttgtgcctacccgtatcc. Outer Right Sequence: tatggccaattttcagaccc. Inner Left Sequence: gccgttgtcatcatcgtaaa. Inner Right Sequence: ttttgttactgttccagggctt. Inner Primer PCR Length: 1200. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42D4.9 Homozygous. Outer Left Sequence: tgtaacacggcaggttcaaa. Outer Right Sequence: acattccgttttccatttgc. Inner Left Sequence: ttggcgccacttcttcttta. Inner Right Sequence:ccagactgtccaaaatccaga . Inner Primer PCR Length: 1146. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807