Search Strains

More Fields
Strain Species Genotype Add
VC4113 C. elegans K12C11.6(gk5190) I; sre-40(gk5191) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.
CHS1093 C. elegans sre-37(yum1533) sre-38(yum1536) sre-39(yum1537) sre-40(yum1538) sre-41(yum1534) sre-42(yum1535) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.