| BC14726 |
C. elegans |
dpy-5(e907) I; sEx14726. Show Description
sEx14726 [rCes T13F2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| CHS1056 |
C. elegans |
sre-1(yum1398) sre-2(yum1399) sre-3(yum1400) II; sre-4(yum1401) sre-5(yum1402) IV; sre-6(yum1403) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1039 |
C. elegans |
sre-43(yum1311) sre-44(yum1312) sre-45(yum1313) sre-46(yum1314) sre-47(yum1315) sre-48(yum1316) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1093 |
C. elegans |
sre-37(yum1533) sre-38(yum1536) sre-39(yum1537) sre-40(yum1538) sre-41(yum1534) sre-42(yum1535) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1202 |
C. elegans |
sre-26(yum2213) sre-27(yum2214) sre-28(yum2215) sre-32(yum2216) sre-33(yum2217) sre-49(yum2218) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| RB2178 |
C. elegans |
sre-48(ok2945) II. Show Description
Y39G8B.3. Homozygous. Outer Left Sequence: AGGTGCACACCTTTTTGCAT. Outer Right Sequence: ACCTTTTGGAAAAATTGCGA. Inner Left Sequence: AGCGACTGGGTGAAACAGAA. Inner Right Sequence: GCACCTGAATAATGCGAAAAA. Inner Primer PCR Length: 1272 bp. Deletion Size: 508 bp. Deletion left flank: GTCTCTGTCTCCTTTTTCAGCTCTTCGCAC. Deletion right flank: AGAATTTTCTAGAATTTTCCAAAAGGTTTC. Insertion Sequence: . Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4113 |
C. elegans |
K12C11.6(gk5190) I; sre-40(gk5191) II. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5190 mutation is G->A, flanking sequences CAAAAATCGAGATGAGTTAGTAAGCCGGAG and TGAGTTAATCATACAAAATCAAAAAAAAAA. The gk5191 mutation is A->C, flanking sequences CCAATCTATAGCATAGTATAAAAATATTTC and TATTCTTGAAAGAAGTTATAATATTGCAGA.
|
|