| NK2962 |
C. elegans |
rrf-3(pk1426) II; zmp-1(qy17[zmp-1::mNG::GPI]) III. Show Description
mNG and GPI tags inserted into the C-terminus of the endogenous zmp-1 locus.
|
|
| NK2841 |
C. elegans |
nduf-7(qy170[nduf-7::mNG]) I. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nduf-7 locus. Insertion verified by PCR. Left flanking sequence: 5' GCCGATTTGATTTTCGTTGCCG 3' ; Right flanking sequence: 5' GGCGAATTTGAATGGTCCAGT 3'. sgRNA: 5' GTAAGCGAGAAGCTCAACTT 3'.
|
|
| NK2844 |
C. elegans |
cox-6A(qy173[cox-6A::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous cox-6A locus. Insertion verified by PCR. Left flanking sequence: 5' AAGGTATCCGACATGAACCGT 3' ; Right flanking sequence: 5' CCATTCAAGCTTTACAGGGTTC 3'. sgRNA: 5' TCAGCCTCGAATCCAACTCC 3'.
|
|
| NK2845 |
C. elegans |
nduv-2(qy174[nduv-2::mNG]) V. Show Description
mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. Insertion verified by PCR. Left flanking sequence: 5' AGATGTCGTTGGCATCGAACGT 3' ; Right flanking sequence: 5' CTTGATCGGTGGTGATAGCTGA 3'. sgRNA: 5' GCTGCTCTTAAATAAACGCT 3'.
|
|
| NK3087 |
C. elegans |
cpIs91 II; nduv-2(qy174[nduv-2::mNG]) V. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II. mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. lag-2 driven red plasma membrane marker.
|
|
