Search Strains

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gctcggaagtATGTCGTTGGCTCAATCTACCTTCT right flanking sequence: ACCTTCTATTTGTTGCATTTTTGGCAGTTGTGATC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGCAACAAATAGAAGGTAGA Method Reference: G3 (Bethesda).

sIs12377 [rCes C45G9.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).