Search Strains

More Fields
Strain Species Genotype Add
CHS1109 C. elegans frpr-1(yum1645) frpr-2(yum1646) X; frpr-14(yum1647) II; frpr-17(yum1648) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS8430 C. elegans frpr-17(sy1302) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-17. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GCAGTTAATCAGTCATGATATTATCGATCCAAGCT right flanking sequence: CAGTGGGATTTCAAAACTGTGAACCTTTGgtgag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATTATCGATCCAAGCTCAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616