Search Strains

More Fields
Strain Species Genotype Add
VC4211 C. elegans C03B1.1(gk5297) X. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5297 mutation is C->T, flanking sequences TTGTACGACGAGTCATGCTGTGTTGGAGCC and GAGGTCGTGATGTCTATCTAAATTTCGGTC.
RB2375 C. elegans lmp-1(ok3228) X. Show Description
C03B1.12 Homozygous. Outer Left Sequence: caattttggttggagaggga. Outer Right Sequence: tcacattcaactcgcgtagc. Inner Left Sequence: cgtaaagtcatcgtacgggc. Inner Right Sequence: gctctgctctcgtagcacaa. Inner Primer PCR Length: 1217. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807