Strain Information
| Name | ZT70 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | csr-1(fj150fj163) Ⅳ |
| Description | No apparent phenotype. fj150fj163 was obtained by repairing the fj150 allele to have the wild-type peptide sequence. fj150fj163 is distinguishable from the wild-type allele by silent codon substitutions, one of which generates a new MfeI site. The fj150fj163 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with MfeI. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Hiroaki Tabara |
| Laboratory | YK |
| Reference | Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Sign in
or
register an account if you want to order this strain.