Strain Information

Name ZT70   View On Wormbase
Species C. elegans
Genotypecsr-1(fj150fj163) Ⅳ
DescriptionNo apparent phenotype. fj150fj163 was obtained by repairing the fj150 allele to have the wild-type peptide sequence. fj150fj163 is distinguishable from the wild-type allele by silent codon substitutions, one of which generates a new MfeI site. The fj150fj163 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with MfeI.
Mutagen Crispr/Cas9
Outcrossedx1
Made byHiroaki Tabara
Laboratory YK
Reference Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Sign in or register an account if you want to order this strain.