Strain Information
| Name | ZT66 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | csr-1(fj160) Ⅳ |
| Description | RNAi deficient (Rde). High incidence of males (Him). fj160 at the second K-rich region in CSR-1 is another mutation changing WK to FS and generates a new FspI site. fj160 is distinguishable from fj150 by a silent codon substitution. The fj150 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x1 |
| Made by | Hiroaki Tabara |
| Laboratory | YK |
| Reference | Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Sign in
or
register an account if you want to order this strain.