Strain Information

Name ZT66   View On Wormbase
Species C. elegans
Genotypecsr-1(fj160) Ⅳ
DescriptionRNAi deficient (Rde). High incidence of males (Him). fj160 at the second K-rich region in CSR-1 is another mutation changing WK to FS and generates a new FspI site. fj160 is distinguishable from fj150 by a silent codon substitution. The fj150 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI.
MutagenCrispr/Cas9
Outcrossedx1
Made byHiroaki Tabara
Laboratory YK
Reference Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
Sign in or register an account if you want to order this strain.