Strain Information

Name GLW37   View On Wormbase
Species C. elegans
Genotypelin-5(utx29[mNG::3xFlag::lin-5]) II.
DescriptionN-terminal tag of LIN-5 via CRISPR/Cas9 knock-in of mNeonGreen at lin-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ttttctttgaataattactccttctgcaga 3'; Right flank: 5' ATGAGCGTGAGCACATCAGTTGTGAAGTCA 3'; sgRNA: GCTCACGCTCATtctgcaga; Cas9/sgRNA plasmid: pGLOW32; mNG^SEC^3xFlag plasmid: pGLOW33; SEC insertion allele strain (balanced): GLW36.
MutagenCRISPR/Cas9 homologous recombination
Outcrossedx0
Made byAlex Koh (Glow Worms '20)
Laboratory GLW
Reference N/A
Sign in or register an account if you want to order this strain.