Laboratory Information

NameSX View on WormBase
Allele designationmj
HeadEric Alexander Miska
InstitutionUniversity of Cambridge, Cambridge, UK
Address Department of Biochemistry
Sanger Building
80 Tennis Court Road
Cambridge CB2 1GA
United Kingdom
Website https://www.ericmiskalab.org/
Gene classes prde 

Strains contributed by this laboratory

Strain Genotype Species Description
MT14521 prg-1(n4503) I. C. elegans Transposon silencing abnormal.
MT14531 prg-2(nDf57) IV. C. elegans Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone).
SX1287 mjIs145 II; unc-119(ed3) III. C. elegans mjIs145 [mex-5p::GFP::his-58::21UR-1sense::tbb-2 3'UTR] II. Control piRNA sensor strain accompanying SX1316. Instead of antisense 21UR-1 target site, this transgene contains the piRNA sequence in sense and histone GFP is not silenced. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
SX1316 mjIs144 II; unc-119(ed3) III. C. elegans mjIs144 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. piRNA sensor strain. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type with loss of piRNA sensor silencing in piRNA pathway mutants (e.g. prg-1). GFP is silenced in wild-type, expressed in piRNA pathway mutants and can be used as a simple read-out for piRNA pathway function. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
SX1359 pash-1(mj100) I; mjEx331. C. elegans mjEx331 [eft-3p::pash-1::GFP::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. Maintain at 25C. Array rescues pash-1 lethality and should be self-selecting at 25C. Pick mCherry(+) animals to confirm presence of array. SX1359 was derived from SX1137 pash-1(mj100). mj100 homozygotes can be re-isolated by raising SX1359 at permissive temperature (15C) and picking animals that have lost the array. Reference: Lehrbach NJ, et al. RNA. 2012 Dec;18(12):2220-35.
SX157 prg-1(n4357) I; unc-22(st136) IV. C. elegans Transposon silencing normal.
SX158 prg-1(n4357) I; unc-22(r750) IV. C. elegans Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]
SX166 prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. C. elegans Transposon silencing normal.
SX178 prg-1(n4357) I; unc-22(r765) IV. C. elegans Twitching due to transposon insertion in unc-22.
SX2499 prde-1(mj207) V. C. elegans piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2500 prde-1(mj258) V. C. elegans piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX2650 mjSi74 I. C. elegans mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96.
SX278 prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. C. elegans Transposon silencing normal.
SX3073 mjIs588 II; unc-119(ed3) III C. elegans mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
SX3117 emb-4(mjSi92[OLLAS::emb-4]) V. C. elegans mjSi92[OLLAS::emb-4]. Endogenous emb-4 locus tagged with OLLAS epitope. No visible phenotype. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6.
SX328 mjIs17 IV. C. elegans mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)].
SX333 mjIs11 III; mjIs17 IV. C. elegans mjIs11contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry:unc-54 (let-7 sensor)].
SX340 unc-32(e189) mut-7(pk204) pha-1(e2123) III; ccEx7271. C. elegans ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal.
SX392 mjEx142. C. elegans mjEx142 [mir-124p::mCherry]. Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.
SX494 prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. C. elegans Transposon silencing abnormal. Twitchers.
SX523 prg-1(n4357) I; prg-2(n4358) IV. C. elegans 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below.
SX620 mir-124(n4255) IV; lin-15B&lin-15A(n765) X; mjIs27. C. elegans mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.
SX621 lin-15B&lin-15A(n765) X; mjIs27. C. elegans mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93.
SX9 prg-1(n4503) I; prg-2(nDf57) IV. C. elegans Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.
SX921 prg-2(n4358) IV. C. elegans Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.
SX922 prg-1(n4357) I. C. elegans 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.

Alleles contributed by this laboratory

Allele Type DNA Change Protein Change
mj100 Allele substitution
mj207 Allele substitution nonsense
mj258 Allele substitution nonsense