Laboratory Information
| Name | SX View on WormBase |
|---|---|
| Allele designation | mj |
| Head | Eric Alexander Miska |
| Institution | University of Cambridge, Cambridge, UK |
| Address | Department of Biochemistry Sanger Building 80 Tennis Court Road Cambridge CB2 1GA United Kingdom |
| Website | https://www.ericmiskalab.org/ |
| Gene classes | prde |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| MT14521 | prg-1(n4503) I. | C. elegans | Transposon silencing abnormal. |
| MT14531 | prg-2(nDf57) IV. | C. elegans | Deletion breakpoints: ATCGGGATGAAGTTTGCAAA//AATCTAGAATACCGATTTCG. Transposon silencing abnormal. Only enhanced transposon activity observed in n4503; nDf57 mutants compared to n4503 (not in nDf57 mutants alone). |
| SX1287 | mjIs145 II; unc-119(ed3) III. | C. elegans | mjIs145 [mex-5p::GFP::his-58::21UR-1sense::tbb-2 3'UTR] II. Control piRNA sensor strain accompanying SX1316. Instead of antisense 21UR-1 target site, this transgene contains the piRNA sequence in sense and histone GFP is not silenced. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8. |
| SX1316 | mjIs144 II; unc-119(ed3) III. | C. elegans | mjIs144 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. piRNA sensor strain. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type with loss of piRNA sensor silencing in piRNA pathway mutants (e.g. prg-1). GFP is silenced in wild-type, expressed in piRNA pathway mutants and can be used as a simple read-out for piRNA pathway function. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8. |
| SX1359 | pash-1(mj100) I; mjEx331. | C. elegans | mjEx331 [eft-3p::pash-1::GFP::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. Maintain at 25C. Array rescues pash-1 lethality and should be self-selecting at 25C. Pick mCherry(+) animals to confirm presence of array. SX1359 was derived from SX1137 pash-1(mj100). mj100 homozygotes can be re-isolated by raising SX1359 at permissive temperature (15C) and picking animals that have lost the array. Reference: Lehrbach NJ, et al. RNA. 2012 Dec;18(12):2220-35. |
| SX157 | prg-1(n4357) I; unc-22(st136) IV. | C. elegans | Transposon silencing normal. |
| SX158 | prg-1(n4357) I; unc-22(r750) IV. | C. elegans | Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.] |
| SX166 | prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. | C. elegans | Transposon silencing normal. |
| SX178 | prg-1(n4357) I; unc-22(r765) IV. | C. elegans | Twitching due to transposon insertion in unc-22. |
| SX2499 | prde-1(mj207) V. | C. elegans | piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96. |
| SX2500 | prde-1(mj258) V. | C. elegans | piRNA biogenesis mutant. Reduced brood size. Maintain at 20C. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96. |
| SX2650 | mjSi74 I. | C. elegans | mjSi74 [mex-5p::wormCherry::prde-1::par-5] I. Integration into ttTi4348. Reference: Weick EM, et al. Genes Dev. 2014 Apr 1;28(7):783-96. |
| SX278 | prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. | C. elegans | Transposon silencing normal. |
| SX3073 | mjIs588 II; unc-119(ed3) III | C. elegans | mjIs588 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. mjIs588 was derived by removing introns 2 and 3 from the construct used to generate the mjIs144 transgene. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type. mjIs588 GFP is silenced in wild-type animals and de-silenced in hrde-1 mutant animals. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6. |
| SX3117 | emb-4(mjSi92[OLLAS::emb-4]) V. | C. elegans | mjSi92[OLLAS::emb-4]. Endogenous emb-4 locus tagged with OLLAS epitope. No visible phenotype. Reference: Akay A, et al. Dev Cell. 2017 Aug 7;42(3):241-255.e6. |
| SX328 | mjIs17 IV. | C. elegans | mjIs17 contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]. |
| SX333 | mjIs11 III; mjIs17 IV. | C. elegans | mjIs11 contains [myo-2::let-7 + unc-119(+)]. mjIs17contains [myo-2::GFP::lin-41 + myo-2::mCherry::unc-54 (let-7 sensor)]. |
| SX340 | unc-32(e189) mut-7(pk204) pha-1(e2123) III; ccEx7271. | C. elegans | ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal. |
| SX392 | mjEx142. | C. elegans | mjEx142 [mir-124p::mCherry]. Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93. |
| SX494 | prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. | C. elegans | Transposon silencing abnormal. Twitchers. |
| SX523 | prg-1(n4357) I; prg-2(n4358) IV. | C. elegans | 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below. |
| SX620 | mir-124(n4255) IV; lin-15B&lin-15A(n765) X; mjIs27. | C. elegans | mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93. |
| SX621 | lin-15B&lin-15A(n765) X; mjIs27. | C. elegans | mjIs27 [mir-124p::GFP + lin-15(+)]. GFP expression in ~40 neurons, most of which are ciliated sensory neurons (AWC, AWA, AWB, ASH, ASI, ASK, PVQ (not ciliated), ASE, PHA, PHB, PVD (not ciliated), IL1, ADE, PDE). Reference: Clark AM, et al. Nucleic Acids Res. 2010 Jun;38(11):3780-93. |
| SX9 | prg-1(n4503) I; prg-2(nDf57) IV. | C. elegans | Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased. |
| SX921 | prg-2(n4358) IV. | C. elegans | Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA. |
| SX922 | prg-1(n4357) I. | C. elegans | 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT. |
Alleles contributed by this laboratory
| Allele | Type | DNA Change | Protein Change |
|---|---|---|---|
| mj100 | Allele | substitution | |
| mj207 | Allele | substitution | nonsense |
| mj258 | Allele | substitution | nonsense |