Laboratory Information
| Name | OEB View on WormBase |
|---|---|
| Allele designation | oq |
| Head | Oliver E Blacque |
| Institution | University College, Dublin, Ireland |
| Address | UCD Conway Institute University College Dublin Belfield Dublin Dublin 4 Ireland |
| Website | http://www.ucd.ie/conway/research/researchers/conwayfellowsa-z/droliverblacque/home/ |
| Gene classes |
Strains contributed by this laboratory
| Strain | Genotype | Species | Description |
|---|---|---|---|
| OEB730 | oqEx500. | C. elegans | oqEx500 [tmem-107::GFP + unc-122p::DsRed]. Pick DsRed+ animals to maintain. TMEM-107::GFP accumulates in the ciliary transition zones of ciliated neurons. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31. |
| OEB800 | tmem-107(oq100) I. | C. elegans | F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31. |
This laboratory hasn't submitted any alleles to the CGC.