Laboratory Information

NameOEB View on WormBase
Allele designationoq
HeadOliver E Blacque
InstitutionUniversity College, Dublin, Ireland
Address UCD Conway Institute
University College Dublin
Belfield
Dublin Dublin 4
Ireland
Website http://www.ucd.ie/conway/research/researchers/conwayfellowsa-z/droliverblacque/home/
Gene classes

Strains contributed by this laboratory

Strain Genotype Species Description
OEB730 oqEx500. C. elegans oqEx500 [tmem-107::GFP + unc-122p::DsRed]. Pick DsRed+ animals to maintain. TMEM-107::GFP accumulates in the ciliary transition zones of ciliated neurons. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.
OEB800 tmem-107(oq100) I. C. elegans F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.
This laboratory hasn't submitted any alleles to the CGC.