Search Strains

More Fields
Strain Species Genotype Add
NK2623 C. elegans ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
NK3086 C. elegans cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.
VC2360 C. elegans ucr-2.3(ok3073) III. Show Description
T24C4.1. External left primer: CGTGCTGGTTCTCGTTATGA. External right primer: CATATGCAGAGATGGCGAGA. Internal left primer: TCACTCAGCCTGGACTTGTG. Internal right primer: TTCTGGACCGTTGTAGAGGG. Internal WT amplicon: 1135 bp. Deletion size: 415 bp. Deletion left flank: GAATTGTGTTTGAGGATATTCATCGCGCTG. Deletion right flank: CTTCTCCACTGAAATTTGCATCACTTCCAG. Insertion Sequence: TTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807