Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GE2940 C. elegans unc-32(e189) pnm-2(t1445)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
MT1445 C. elegans egl-35(n694) III. Show Description
Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.
OH18902 C. elegans degt-1(ot1445[degt-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
MT14450 C. elegans mir-51(n4473) IV. Show Description
Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14451 C. elegans mir-76(n4474) III. Show Description
Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14452 C. elegans mir-46(n4475) III. Show Description
Deletion breakpoints are:CTATGAATGTTTAAAA / AAAAAAATTTTTTGAAAAGTAAGCAA...AGAGCCCTAAAAGTCTTAACT / GTTCTGCGCAACTTTCGACAACGTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.