Search Strains

More Fields
Strain Species Genotype Add
GE2929 C. elegans unc-32(e189) pna-2(t1434)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
MT1434 C. elegans egl-30(n686) I. Show Description
Egg-laying defective. Retains late stage eggs. Semi-dominant. Unc-slow moving.
OH18872 C. elegans ceh-44(ot1434[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 1-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
OH19219 C. elegans ceh-44(ot1515[*ot1015[ceh-44::gfp]]) III. Show Description
ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1434 is a deletion removing exons 5-7 from the endogenously-tagged ceh-44 locus. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain.
MT14347 C. elegans mir-273(n4438) II. Show Description
Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.