Search Strains

More Fields
Strain Species Genotype Add
VC4095 C. elegans srz-5(gk5186) II; R09H10.7(gk5187) IV; F54B11.7(gk5188) X. Show Description
Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.
CHS1250 C. elegans srz-1(yum2552) V; srz-3(yum2553) srz-4(yum2554) I; srz-5(yum2555) srz-6(yum2556) II; srz-8(yum2557) srz-9(yum2558) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1112 C. elegans srz-58(yum1662) V; srz-59(yum1663) srz-60(yum1664) srz-61(yum1665) srz-62(yum1666) IV; srz-85(yum1667) I. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1136 C. elegans srz-42(yum1789) IV; srz-44(yum1790) srz-47(yum1791) srz-48(yum1792) srz-54(yum1793) V; srz-56(yum1794) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
OH14265 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6628. Show Description
otEx6628 [srz-54p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14838 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6909. Show Description
otEx6909 [srz-56p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.