Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC4132 C. elegans srz-38(gk5214) IV. Show Description
Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5214 mutation is C->T, flanking sequences TTACTGTTTCCAGCAGTCAATCATTTCTAT and AAATGACAAGAAACGTTTTTTTCCTCTGCA.
CHS1130 C. elegans srz-25(yum1757) V; srz-29(yum1758) srz-31(yum1759) srz-32(yum1760) srz-37(yum1761) srz-38(yum1762) srz-72(yum1762) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.