Search Strains

More Fields
Strain Species Genotype Add
BC14844 C. elegans dpy-5(e907) I; sEx14844. Show Description
sEx14844 [rCes F14F8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
CHS1250 C. elegans srz-1(yum2552) V; srz-3(yum2553) srz-4(yum2554) I; srz-5(yum2555) srz-6(yum2556) II; srz-8(yum2557) srz-9(yum2558) III. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1122 C. elegans srz-69(yum1715) srz-70(yum1716) srz-71(yum1717) srz-104(yum1713) srz-105(yum1714) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1139 C. elegans srz-16(yum1808) srz-18(yum1809) V; srz-19(yum1810) srz-20(yum1811) srz-23(yum1813) srz-24(yum1812) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1224 C. elegans srz-10(yum2351) srz-11(yum2352) srz-12(yum2353) srz-13(yum2354) srz-14(yum2355) srz-15(yum2356) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1239 C. elegans srz-94(yum2461) srz-95(yum2462) srz-96(yum2463) srz-97(yum2464) srz-99(yum2465) srz-100(yum2466) srz-101(yum2467) srz-102(yum2468) srz-103(yum2469) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
OH14343 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6700. Show Description
otEx6700 [srz-102p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14840 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6911. Show Description
otEx6911 [srz-104p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
PS8263 C. elegans srz-103(sy1254) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srz-103; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATTAATTGTAGCGTATATTCTCATATGTCGTA Right flanking sequence: ATCTGGATGTTCTTCAAAGATTGCCAATTGTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TATTCTCATATGTCGTAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616