Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CHS1147 C. elegans srx-5(yum1864) srx-6(yum1865) srx-7(yum1866) srx-8(yum1867) srx-9(yum1868) srx-10(yum1869) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1146 C. elegans srx-48(yum1857) V; srx-50(yum1858) IV; srx-51(yum1859) srx-54(yum1860) srx-59(yum1862) srx-64(yum1863) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1242 C. elegans srx-56(yum2484) srx-58(yum2485) srx-60(yum2486) srx-62(yum2487) srx-63(yum2488) srx-65(yum2489) srx-66(yum2490) srx-67(yum2491) srx-68(yum2492) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS8118 C. elegans srx-51(sy1194) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-51; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAACTCATTTGGAATGCTGACTACATCACAGTCTA Right flanking sequence: TTGGGGATGCAGTTATTTCAACAATTTTTGCATTT inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GACTACATCACAGTCTATTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616