Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CHS1060 C. elegans srx-12(yum1413) srx-13(yum1414) srx-14(yum1415) IV; srx-33(yum1416) srx-34(yum1417) srx-36(yum1418) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS9366 C. elegans srx-12(sy1746) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCATTGCAAATTTTGGGGTTCTATTTGTATTCTGC right flanking sequence: ACATGGGTCACGCCGACCACTATTATgtaggtttttg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTATTTGTATTCTGCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
CHS1154 C. elegans srx-116(yum1909) srx-117(yum1910) srx-118(yum1911) srx-119(yum1912) srx-120(yum1913) srx-121(yum1914) srx-122(yum1915) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1232 C. elegans srx-114(yum2402) srx-115(yum2403) srx-125(yum2404) srx-128(yum2405) srx-129(yum2406) srx-131(yum2407) srx-136(yum2408) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.