| CHS1135 |
C. elegans |
srx-1(yum1785) srx-2(yum1786) srx-3(yum1787) srx-4(yum1788) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1060 |
C. elegans |
srx-12(yum1413) srx-13(yum1414) srx-14(yum1415) IV; srx-33(yum1416) srx-34(yum1417) srx-36(yum1418) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1107 |
C. elegans |
srx-19(yum1634) IV; srx-24(yum1635) srx-26(yum1636) srx-28(yum1637) srx-29(yum1638) srx-31(yum1639) srx-32(yum1640) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1141 |
C. elegans |
srx-101(yum1821) srx-102(yum1822) srx-104(yum1823) srx-105(yum1824) srx-108(yum1825) srx-110(yum1826) srx-111(yum1827) srx-112(yum1828) II; srx-113(yum1829) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1147 |
C. elegans |
srx-5(yum1864) srx-6(yum1865) srx-7(yum1866) srx-8(yum1867) srx-9(yum1868) srx-10(yum1869) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1154 |
C. elegans |
srx-116(yum1909) srx-117(yum1910) srx-118(yum1911) srx-119(yum1912) srx-120(yum1913) srx-121(yum1914) srx-122(yum1915) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1187 |
C. elegans |
srx-16(yum2117) srx-17(yum2118) srx-18(yum2119) srx-20(yum2120) srx-21(yum2121) srx-22(yum2122) srx-23(yum2123) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1232 |
C. elegans |
srx-114(yum2402) srx-115(yum2403) srx-125(yum2404) srx-128(yum2405) srx-129(yum2406) srx-131(yum2407) srx-136(yum2408) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1245 |
C. elegans |
srx-130(yum2518) srx-133(yum2519) srx-134(yum2520) srx-135(yum2521) srx-137(yum2522) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| OH13865 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6429. Show Description
otEx6429 [srx-1p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH13871 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6435. Show Description
otEx6435 [srx-10p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| OH13873 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; otEx6437]. Show Description
otEx6437 [srx-17p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
|
|
| PS9366 |
C. elegans |
srx-12(sy1746) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-12. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CCATTGCAAATTTTGGGGTTCTATTTGTATTCTGC right flanking sequence: ACATGGGTCACGCCGACCACTATTATgtaggtttttg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTATTTGTATTCTGCACA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|