Search Strains

More Fields
Strain Species Genotype Add
PS8234 C. elegans srw-54(sy1234) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-54; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTTGGTACGATCTGCAAAACATCATCAGGCCTATT Right flanking sequence: GATGTGTACTTGGATTACTTCAACTTTTCAATATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAATCCAAGTACACATCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
CHS1051 C. elegans srw-51(yum1374) srw-53(yum1375) srw-54(yum1376) srw-55(yum1377) t27c5.10(yum1378) y70c5a.4(yum1379) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.