Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CHS1235 C. elegans srv-24(yum2423) srv-25(yum2424) srv-26(yum2425) srv-27(yum2426) srv-28(yum2427) srv-29(yum2428) srv-30(yum2429) srv-31(yum2430) srv-32(yum2431) ops-1(yum2432) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS9378 C. elegans srv-28(sy1752) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-28. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTATACTATGGAATGTCGATTTTAAGTCTTCCCTTATA right flanking sequence: CTTTGGTGTTCTCATTTGTTTGTTGAGATTGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTAAGTCTTCCCTTATACTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616