Search Strains

More Fields
Strain Species Genotype Add
CHS1092 C. elegans srsx-35(yum1527) srsx-36(yum1528) srsx-37(yum1529) srsx-38(yum1530) srsx-39(yum1531) srsx-40(yum1532) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS9502 C. elegans srsx-40(sy1800) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srsx-40. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTTATTTTGACAATCGACAGAATAATTGCCACGT right flanking sequence: GTACACCTATTCAATACAAGAATTTGAAACATTGTG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTATTGAATAGGTGTACACG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616