Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CHS1175 C. elegans srg-46(yum2038) srg-47(yum2039) V; srg-48(yum2040) srg-50(yum2041) srg-51(yum2042) IV; srg-53(yum2043) V; y54g2a.38(yum2045) y54g2a.77(yum2044) IV; ah9.1(yum2046) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
PS9376 C. elegans srg-48(sy1750) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-48. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTCTCCAGAACTATTCAATTTCTTCATGTTTTGCG right flanking sequence: GGCTGGCATTTCTTCATCTTCAGTCATGTAGTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTTCATGTTTTGCGGGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616