Search Strains

More Fields
Strain Species Genotype Add
BC2513 C. elegans dpy-18(e364)/eT1 III; dpy-11(e224) let-407(s830)/eT1 V. Show Description
WT strain that segregates WT, Unc-36, dead eggs and DpyLets. Lethal early larval. Maintain by picking WT.
PS8301 C. elegans oac-40(sy1258) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAAATTTCTTATGGGAAACTAATAACCGGTA Right flanking sequence: TTCGTTGGCTTCATTATTTTTAGTCACAAATCAAC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAATGAAGCCAACGAATAC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8303 C. elegans oac-59(sy1260) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-59; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACCGTCTTCAAAACGGCTGGACCTTCAAGGCAT. Right flanking sequence: TAGAGGGTTGGCAATTCTATCAGTTCTGGGATTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGACCTTCAAGGCATTAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8305 C. elegans nlp-78(sy1262) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-78; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGCTTTCTCAAACATCTGTAGTGCGTATCCAGAT Right flanking sequence: TATCGACTTCCTGAAAGAgtaagttttgagaatttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTTCAGGAAGTCGATAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8307 C. elegans nlp-80(sy1264) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-80; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTCTCTTGTGTATTCTGTTTGCTTTATCCGAAG Right flanking sequence: CTTACAGTCGCATGGAGTTGGAgtaagttaagaac inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCATGCGACTGTAAGCTT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616