Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
COP1918 C. elegans rskn-1(knu796) I. Show Description
Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
NL742 C. elegans rskn-1(pk209::Tc1) mut-2(r459) I. Show Description
Dpyish. Primers used to isolate pk209 are: cgatcctcgacagtttgaactgc & cgagattcagggcatgtctatgc.
BS3760 C. elegans rskn-1(ok159) I. Show Description
Ectopic ERK MPK-1 (detected by dpMPK-1 immunostaining) in the loop region. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236