Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields
Strain Species Genotype Add
NK2623 C. elegans ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
mNeonGreen tag inserted into the endogenous ucr-2.1 locus (C-terminus tag). Insertion verified by PCR. Left flanking sequence: 5' TCAGAAGGAACGACTCGTTG 3' ; Right flanking sequence: 5' CGAAAGTAGAATGCTAGTCAAG 3'. sgRNA: 5' TTTATAGCTCGTCGAGATAT 3'. Superficially wild-type.
NK3086 C. elegans cpIs91 II; ucr-2.1(qy92[ucr-2.1::mNG]) X. Show Description
cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.