Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
OK286 C. elegans pyr-1(cu8) II. Show Description
Partially penetrant Mel.
RB568 C. elegans svh-5(ok286) X. Show Description
C33A11.4/tag-97. Homozygous. Outer Left Sequence: GTTTATAGTCTGGTCTCACACAAGG. Outer Right Sequence: AATCGTCTGGTGTCTGTTTGACC. Inner Left Sequence: TACGAGCTGCACCAGATCTCG. Inner Right Sequence: TTACAGATTCTTCGTGAGACC. Inner primer WT PCR product: 3537. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2146 C. elegans C50F4.14(ok2860) V. Show Description
C50F4.14. Homozygous. Outer Left Sequence: AAGCAGTGGCTACCAACCAT. Outer Right Sequence: CCCGCCTTAACTACCATTCA. Inner Left Sequence: AAATGCAAACTTCGAGCAGC. Inner Right Sequence: GAATCCAACCAAATGGGAGA. Inner Primer PCR Length: 1274 bp. Deletion Size: 722 bp. Deletion left flank: GCTTCACTTTGTCAGATTTTGCCTCGCTAG. Deletion right flank: AAAACGGTCGTTAAACTACGTCCAACATAG. Insertion Sequence: TTTGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2147 C. elegans acs-13(ok2861) I. Show Description
Y65B4BL.5. Homozygous. Outer Left Sequence: TATTCGGCTTTGAGGAGAGC. Outer Right Sequence: AAAGGCCACTGGTGAGTTTG. Inner Left Sequence: TGAACAAATGATTGAGCGACA. Inner Right Sequence: ACCGATGAGCTCAAAACGAC. Inner Primer PCR Length: 1131 bp. Deletion Size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.] Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2148 C. elegans F53B6.2(ok2862) I. Show Description
F53B6.2. Homozygous. Outer Left Sequence: GCTGTTCACGTGCTTTTTCA. Outer Right Sequence: AATGAGCAGGGTTTTTGTGG. Inner Left Sequence: CATTTGGTGCGGTAAGCAAT. Inner Right Sequence: TTCCAGATCAAGAGCAACCA. Inner Primer PCR Length: 1290 bp. Deletion Size: 631 bp. Deletion left flank: GCCACTCCACCAATTCCCAATGTCAATTTC. Deletion right flank: CTGAATGCATTTGAGAGCAGCTTTTTGTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2046 C. elegans acs-13(ok2815) I. Show Description
Y65B4BL.5. External left primer: TATTCGGCTTTGAGGAGAGC. External right primer: AAAGGCCACTGGTGAGTTTG. Internal left primer: TGAACAAATGATTGAGCGACA. Internal right primer: ACCGATGAGCTCAAAACGAC. Internal WT amplicon: 1131 bp. Deletion size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2123 C. elegans sri-14(ok2865) I. Show Description
M01G12.1. External left primer: CTGCTGCGTTTTTCGTATCA. External right primer: AAGAGCGAATGGATTTGGTG. Internal left primer: TCAGTCTGATCATTTTTCCTTCAA. Internal right primer: TGATTGGTCGGTCATTCAAA. Internal WT amplicon: 1166 bp. Deletion size: 532 bp. Deletion left flank: ACGTCGATTGCTTTTTGACTTCGCAGAAAT. Deletion right flank: ACAAAGTGGCACAACTATAAAAACGCCAGGAAGCACTATTTGCATGACTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2139 C. elegans C09F5.1(ok2863) III. Show Description
C09F5.1. External left primer: GTGGAGCAAATCGAGGTCAT. External right primer: CCACACAAGAATGTGTTGGC. Internal left primer: GCATCGAATAATTGAAGAGGG. Internal right primer: CCACGTCTTCTCTAGTGGGC. Internal WT amplicon: 1262 bp. Deletion size: 403 bp. Deletion left flank: TTTACTTTTCGGCACGTGGCGTCAGAGTGT. Deletion right flank: ATGATATTCACGAAGTGCGCACTGATGGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2140 C. elegans ift-74(ok2866) II. Show Description
C18H9.8. External left primer: GATGCCTGTGTCAAGAGCTG. External right primer: CCACTTCAACCTTGCCAACT. Internal left primer: GGACCTCCAAGAGCACCTACT. Internal right primer: ACGCACAATTCCATGAAGAA. Internal WT amplicon: 1310 bp. Deletion size: 488 bp. Deletion left flank: ACATTTTCCAGACTCCCGTCAAGTATTTGA. Deletion right flank: AGCTTTTAAGAGAAAGAGTTGTAGAAATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2141 C. elegans C27B7.7(ok2868) IV. Show Description
C27B7.7. External left primer: CATGACGTCGGTTACACTGG. External right primer: CTCCGGGTCCTGAAACATTA. Internal left primer: GCCAAATCTGTTTGAAGAACTG. Internal right primer: GCATGGATTCGTGTCTTCCT. Internal WT amplicon: 1144 bp. Deletion size: 409 bp. Deletion left flank: CTCTTTTCTAAAATAAAATATTGGTGTTCA. Deletion right flank: TGGAATATTTTGAAGTTCTCTCTTATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2149 C. elegans T12G3.1(ok2869) IV. Show Description
T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2167 C. elegans gck-2(ok2867) V. Show Description
ZC404.9. External left primer: TAGTCGATCCGCGTACACAA. External right primer: GGACCACTTTCGGAACTTCA. Internal left primer: AGATAGATTTCCATCCGGCA. Internal right primer: AAACTTTGCGTGGCTTGAAT. Internal WT amplicon: 1258 bp. Deletion size: 549 bp. Deletion left flank: TTCTTTCAGAATGATATCCTCGATTCAAAC. Deletion right flank: GTTTTTCAACACAAGCAACTTCCGGAGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2202 C. elegans T05G5.8(ok2864) III. Show Description
T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807