| CP101 |
C. briggsae |
Cbr-puf-2(nm66)/Cbr-dpy-?(nm4) II. Show Description
Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.
|
|
| CP4 |
C. briggsae |
Cbr-dpy-?(nm4) II. Show Description
Dpy. Tightly linked to Cbr-tra-2 on LG II. Molecular identity unknown. Reference: Kelleher DF, et al. Genetics. 2008 Mar;178(3):1415-29.
|
|
| NM4244 |
C. elegans |
jsIs973 III; jsIs609 X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. jsIs609 [mec7p::mtGFP + lin-15(+)] X. Strong RFP cytosolic marker for the mechanosensory neurons (Zheng et al. 2011, PMID 21115607). GFP mitochondrial marker expressed in mechanosensory neurons (Mondal et al. 2012, PMID 23051668).
|
|
| NM4337 |
C. elegans |
rep-1(ok3296)/sC1(s2023) [dpy-1(s2170)] III. Show Description
rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4431. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM4397 |
C. elegans |
jsIs973 III; ptrn-1(js1286) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607).
|
|
| NM440 |
C. elegans |
unc-104(e1265) II; jsIs1. Show Description
jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller. Unc. GFP expressed in the nerve ring, ventral cord, dorsal cord.
|
|
| NM4422 |
C. elegans |
jsIs973 III; oxIs12 ptrn-1(tm5597) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. oxIs12 [unc-47p::GFP + lin-15(+)] X. oxIs12 integration maps at +2.0 on X. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607). Expression of GFP in all GABAergic neurons.
|
|
| NM4431 |
C. elegans |
rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
|
|
| NM467 |
C. elegans |
snb-1(md247) V. Show Description
Aldicarb resistant. Lethargic Unc - jerky especially in backward movement. Low pumping rate. Molecular lesion for md247 is a 20 bp duplication yielding a frameshift mid-way through the transmembrane domain.
|
|