| NL1820 |
C. elegans |
mut-7(pk720) III. Show Description
Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.
|
|
| NL917 |
C. elegans |
mut-7(pk204) III. Show Description
Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.
|
|
| WM207 |
C. elegans |
mut-7(ne4255) III. Show Description
Dominant RNAi deficient. Temperature-sensitive sterile. E439K mutation in conserved Mg2+ coordinating residue. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44.
|
|
| BC14993 |
C. elegans |
dpy-5(e907) I; sEx14993. Show Description
sEx14993 contains [rCes ZK1098.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
|
|
| SX340 |
C. elegans |
unc-32(e189) mut-7(pk204) pha-1(e2123) III; ccEx7271. Show Description
ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal.
|
|