Search Strains

More Fields
Strain Species Genotype Add
MT12989 C. elegans mir-53(n4113) IV. Show Description
Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT17446 C. elegans mir-53(n4113) mir-52(n4100) IV; nDf58 X. Show Description
Slow growing. Some larval and adult lethality. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
VT1605 C. elegans unc-119(ed3) III; maIs234. Show Description
maIs234 [mir-53::GFP + unc-119(+)]. Wild type.