Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JJ1271 C. elegans glo-1(zu391) X. Show Description
Lacks autofluorescent and birefringent gut granules.
BK206 C. elegans qpIs98. Show Description
qpIs98 [exc-9p::mCherry::glo-1]. Expression of mCherry-tagged GLO-1 of lysosomes in cytoplasm of excretory canals along nearly entire length of worm. Unknown site of construct integration. Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72. doi: 10.1016/j.ydbio.2011.08.011. PMID: 21889936.
PS8441 C. elegans daf-2 (e1370) III; glo-1(sy1306) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
VK2735 C. elegans vkEx2735. Show Description
vkEx2735 [nhx-2p::glo-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing GLO-1::CemOrange2 under the intestinal-specific nhx-2 promoter. GLO-1 is localized to the lysosome related organelle. Pick animals with GFP+ pharynx to maintain. Reference: Thomas
VK2799 C. elegans vkIs2799. Show Description
vkIs2799 [nhx-2p::glo-1::CemOrange2 + myo-2p::GFP]. Wild-type animals expressing GLO-1::CemOrange2 under the intestinal-specific nhx-2 promoter. GLO-1 is localized to the lysosome related organelle. Integrated; chromosome unkown. Reference: Thomas
VK2881 C. elegans vkIs2881. Show Description
vkIs2881 [nhx-2p::glo-1::CemOrange2 + ges-1p::glo-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and GLO-1::GFP under the Pnhx-2 and Pges-1 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas
VK2882 C. elegans vkIs2882. Show Description
vkIs2882 [nhx-2p::glo-1::CemOrange2 + vha-6p::lmp-1::GFP + myo-2p::GFP]. Wild-type animals expressing both GLO-1::CemOrange2 and LMP-1::GFP under the Pnhx-2 and Pvha-6 intestinal specific promoters, respectively. Integrated; chromosomes unknown. Reference: Thomas
VS17 C. elegans hjIs9. Show Description
hjIs9 [ges-1p::glo-1::GFP + unc-119(+)]. GFP targeted to lysosome related organelles (LROs) in intestinal cells. Reference: Proc Natl Acad Sci U S A. 2010;107(10):4640-5.
QC114 C. elegans etEx2. Show Description
etEx2 [glo-1p::GFP::ras-2 CAAX + rol-6(su1006)]. Rollers. Pick Rollers to maintain. etEx2 contains plasmid pQC09.6, which carries the ras-2 CAAX motif at the C-terminus of GFP; this array is a prenylation reporter. Reference: Mörck C, et al. Proc Natl Acad Sci U S A. 2009 Oct 27;106(43):18285-90.