Caenorhabditis Genetics Center (CGC)

Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MCJ317 C. elegans gldr-2(cdb187) I. Show Description
Superficially wild-type. Reference: Vieux K-F, et al. Nucleic Acids Res. 2021. doi:10.1093/nar/gkab840 PMID: 34586415
MCJ474 C. elegans gldr-2(cdb217[3xFLAG::AID*::GFP::gldr-2]) I. Show Description
3xFLAG::AID*::GFP degron tag inserted at N-terminus of endogenous gldr-2 locus. sgRNA #1: TTTCTCGACATttctgaaag; sgRNA #2: CACATTCATGGGAACTGAAT; sgRNA #3: GCTACCATAGGCACCACGAG. sgRNA #3 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.