Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC136 C. elegans tag-4(gk127) I. Show Description
ZK337.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2368 C. elegans attf-5(gk1279) ceh-90(gk3396) X. Show Description
attf-5 homozygous viable deletion, detectable by nested PCR. ceh-90 homozygous viable deletion, identified by CGH. gk1279: External left primer: ctcccgaaaatccagcatta. External right primer: aactcatggaaaccgtcctg. Internal left primer: ccatagcaactgcgatgatg. Internal right primer: atgagcattagagcgcgatt. Internal WT amplicon: 2677 bp. Deletion breakpoints not determined; deletion of approximately 1030 bp narrowed to 1142-bp region between X coordinates 788497 and 789639 (WS279). Validation: gk1279 confirmed by CGH. gk3396: Left flanking probe AACAACAAACCTGAGCTTCGTTTCGATTCAATAAACCAGCAAGACGATTC; left deleted probe: ATAAACCAGCAAGACGATTCATTTCAGAAGTTCCAGGGTGTGAGTCTTTT; right deleted probe: ACAAGTTTTTCGGATGGAGAATTACCTAAAATGTCGATGAAAGATTATTG; right flanking probe: ATTGAGAGATAGAACCATAGAAAACACTAAATACGCAGATAGGTTATCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2858 C. elegans C40D2.4(gk1276) II. Show Description
C40D2.4. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 518 bp. Deletion left flank: TCTCCTCAAATGCTGAAAGTGAATAAAGAA. Deletion right flank: CAAAAAATATTTTTCAAAAGATAACATAAA. Insertion Sequence: AGGTGATCTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2932 C. elegans coel-1(gk1274) X. Show Description
C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 268 bp. Deletion left flank: TCCCACCGGACGGCGCACGCAACAGCCCGT. Deletion right flank: TTTGAAATTCAAACTGATCTTCTAACAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3004 C. elegans F59E12.3(gk1277) II; srxa-9(gk3141) X. Show Description
ZK678.4, F59E12.3. The gk1277 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 588 bp. Deletion left flank: AGGCAATAAATGTTCATTATCGACTGCCAT. Deletion right flank: ATCGATGGACTAAGCTTCTTTGAGGAGCCA. The gk3141 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3007 C. elegans F53H4.5(gk1273) X. Show Description
F53H4.5. External left primer: CTTCCGTCTTAATTTTTGCACC. External right primer: GCAATATCATCGGCTAATGTCA. Internal left primer: GGGCATAGTTTAAGTCACGTCC. Internal right primer: TTTTTCCAAAACGCTCAAAAAT. Internal WT amplicon: 1259 bp. Deletion size: 430 bp. Deletion left flank: CCAATCAGTGCTCCGCTAAGTGTCAGAGCA. Deletion right flank: ATGTAGATCAGAGCTGTGCAGCAGCCGAGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3008 C. elegans T06G6.5(gk1278) I. Show Description
T06G6.5. External left primer: GCAACCTCTACCGTAACCCA. External right primer: GGGCATATACTCTGGCGAAA. Internal left primer: TTCGCACATATCTGTTGGTTTC. Internal right primer: ATGGGTACATTTTTGGAACTGG. Internal WT amplicon: 1372 bp. Deletion size: 1128 bp. Deletion left flank: ATATCTGTTGGTTTCCATATTTCGAAAATG. Deletion right flank: CCACTTACCATGTAAACACATCTACTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807